Skip to main content

Paired-Tag Overview

Pipeline VersionDate UpdatedDocumentation AuthorQuestions or Feedback
PairedTag_v1.10.0January, 2025WARP PipelinesPlease file an issue in WARP.

pairedtag_diagram

Introduction to the Paired-Tag workflow

The Paired-Tag workflow is an open-source, cloud-optimized pipeline developed in collaboration with the BRAIN Initiative Cell Census Network (BICCN) and the BRAIN Initiative Cell Atlas Network (BICAN). It supports the processing of 3' single-nucleus histone modification data (generated with the paired-tag protocol]) and 10x gene expression (GEX) data generated with the 10x Chromium Multiome assay.

The workflow is a wrapper WDL script that calls two subworkflows: the Optimus workflow for single-nucleus GEX data and the ATAC workflow for single-nucleus histone modification data.

The Optimus workflow (GEX) corrects cell barcodes (CBs) and Unique Molecular Identifiers (UMIs), aligns reads to the genome, calculates per-barcode and per-gene quality metrics, and produces a raw cell-by-gene count matrix.

The ATAC workflow (histone modification) performs demultiplexing for samples that have a preindex barcode, corrects CBs, aligns reads to the genome, calculates per-barcode quality metrics, and produces a fragment file.

The wrapper WDL is available in the WARP repository.

Quickstart table

The following table provides a quick glance at the Paired-Tag pipeline features:

Pipeline featuresDescriptionSource
Assay typeDroplet Paired-Tag (parallel analysis of individual cells for RNA expression and DNA from targeted tagmentation by sequencing)Xie et al. 2023
Overall workflowBarcode correction, read alignment, gene and fragment quantificationCode available on GitHub
Workflow languageWDL 1.0openWDL
Genomic Reference SequenceGRCh38 human genome primary sequenceGENCODE human reference files
Gene annotation reference (GTF)Reference containing gene annotationsGENCODE human GTF
AlignersSTARsolo (GEX), BWA-mem2 (ATAC)Kaminow et al. 2021, Vasimuddin et al. 2019
Transcript and fragment quantificationSTARsolo (GEX), SnapATAC2 (ATAC)Kaminow et al. 2021, SnapATAC2
Data input file formatFile format in which sequencing data is providedFASTQ
Data output file formatFile formats in which Multiome output is providedBAM and h5ad

Set-up

Paired-Tag installation

To download the latest Paired-Tag release, see the release tags prefixed with "PairedTag" on the WARP releases page. All Paired-Tag pipeline releases are documented in the Paired-Tag changelog.

To search releases of this and other pipelines, use the WARP command-line tool Wreleaser.

If you’re running a Paired-Tag workflow version prior to the latest release, the accompanying documentation for that release may be downloaded with the source code on the WARP releases page (see the folder website/docs/Pipelines/PairedTag_Pipeline).

The Paired-Tag pipeline can be deployed using Cromwell, a GA4GH-compliant, flexible workflow management system that supports multiple computing platforms. The workflow can also be run in Terra, a cloud-based analysis platform.

Inputs

The Paired-Tag workflow inputs are specified in JSON configuration files. Example configuration files can be found in the test_inputs folder in the WARP repository.

Input descriptions

Parameter nameDescriptionType
input_idUnique identifier describing the biological sample or replicate that corresponds with the FASTQ files; can be a human-readable name or UUID.String
gex_nhash_idOptional identifier that can be used to demarcate the gene expression library aliquot or sample.
atac_nhash_idOptional identifier that can be used to demarcate the ATAC library aliquot or sample.
counting_modeOptional string that determines whether the Optimus (GEX) pipeline should be run in single-cell mode (sc_rna) or single-nucleus mode (sn_rna); default is "sn_rna".String
gex_r1_fastqArray of read 1 FASTQ files representing a single GEX 10x library.Array[File]
gex_r2_fastqArray of read 2 FASTQ files representing a single GEX 10x library.Array[File]
gex_i1_fastqOptional array of index FASTQ files representing a single GEX 10x library; multiplexed samples are not currently supported, but the file may be passed to the pipeline.Array[File]
tar_star_referenceTAR file containing a species-specific reference genome and GTF for Optimus (GEX) pipeline.File
annotations_gtfGTF file containing gene annotations used for GEX cell metric calculation and ATAC fragment metrics; must match the GTF used to build the STAR aligner.File
mt_genesOptional file for the Optimus (GEX) pipeline containing mitochondrial gene names used for metric calculation; default assumes 'mt' prefix in GTF (case insensitive).File
tenx_chemistry_versionOptional integer for the Optimus (GEX) pipeline specifying the 10x version chemistry the data was generated with; validated by examination of the first read 1 FASTQ file read structure; default is "3".Integer
emptydrops_lowerNot used for single-nucleus data. Optional threshold for UMIs for the Optimus (GEX) pipeline that empty drops tool should consider for determining cell; data below threshold is not removed; default is "100".Integer
force_no_checkOptional boolean for the Optimus (GEX) pipeline indicating if the pipeline should perform checks; default is "false".Boolean
ignore_r1_read_lengthOptional boolean for the Optimus (GEX) pipeline indicating if the pipeline should ignore barcode chemistry check; if "true", the workflow will not ensure the 10x_chemistry_version input matches the chemistry in the read 1 FASTQ; default is "false".Boolean
star_strand_modeOptional string for the Optimus (GEX) pipeline for performing STARsolo alignment on forward stranded, reverse stranded, or unstranded data; default is "Forward".String
count_exonsDeprecated and removed in PairedTag v3.0.0. This parameter is no longer accepted by the workflow; sn_rna mode now always produces a single whole-transcript count matrix.N/A
gex_whitelistOptional file containing the list of valid barcodes for 10x multiome GEX data; default is "gs://gcp-public-data--broad-references/RNA/resources/arc-v1/737K-arc-v1_gex.txt".File
soloMultiMappersOptional string describing whether or not the Optimus (GEX) pipeline should run STARsolo with the --soloMultiMappers flag; default is "EM".String
atac_r1_fastqArray of read 1 paired-end FASTQ files representing a single paired-tag DNA library.Array[File]
atac_r2_fastqArray of barcodes FASTQ files representing a single paired-tag DNA library.Array[File]
atac_r3_fastqArray of read 2 paired-end FASTQ files representing a single paired-tag DNA library.Array[File]
tar_bwa_referenceTAR file containing the reference index files for BWA-mem alignment for the ATAC pipeline.File
chrom_sizesFile containing the genome chromosome sizes; used to calculate ATAC fragment file metrics.File
adapter_seq_read1Optional string describing the adapter sequence for ATAC read 1 paired-end reads to be used during adapter trimming with Cutadapt; default is "GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG".String
adapter_seq_read3Optional string describing the adapter sequence for ATAC read 2 paired-end reads to be used during adapter trimming with Cutadapt; default is "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG".String
atac_whitelistOptional file containing the list of valid barcodes for 10x multiome ATAC adata; default is "gs://gcp-public-data--broad-references/RNA/resources/arc-v1/737K-arc-v1_atac.txt".File
preindexOptional boolean for the ATAC workflow; if “true”, the pipeline will run the ATAC workflow with a preindexing task necessary for processing of droplet-based Paired-Tag data where sample barcodes from read2 are combined with cell barcodes into the BB tag of the output BAM file; if “false”, the pipeline will run the ATAC workflow without preindexing and cell barcodes are stored in the CB tag of the output BAM file; default is “true”.Boolean

Paired-Tag tasks and tools

The Paired-Tag workflow calls two WARP subworkflows and an additional task which are described briefly in the table below. For more details on each subworkflow and task, see the documentation and WDL scripts linked in the table.

Subworkflow/TaskSoftwareDescription
Optimus (WDL and documentation)fastqprocess, STARsolo, EmptydropsWorkflow used to analyze 10x single-cell GEX data.
PairedTagDemultiplex as demultiplex (WDL)UPStoolsTask used to check the length of the read2 FASTQ (should be either 27 or 24 bp). If preindex is set to true, the task will perform demultiplexing of the 3-bp sample barcode from the read2 ATAC fastq files and stores it in the readname. It will then perform barcode orientation checking. The ATAC workflow will then add a combined 3 bp sample barcode and cellular barcode to the BB tag of the BAM. If preindex is false and then length is 27 bp, the task will perform trimming and subsequent barcode orientation checking.
ATAC (WDL and documentation)fastqprocess, bwa-mem, SnapATAC2Workflow used to analyze single-nucleus paired-tag DNA (histone modifications) data.
ParseBarcodes as ParseBarcodes (WDL)python3Task used to parse and split the cell barcodes and sample barcodes from the combined index in the h5ad and fragment files when preindex is set to true.

Outputs

Output variable nameFilename, if applicableOutput format and description
pairedtag_pipeline_version_outN/AString describing the version of the Paired-Tag pipeline used.
bam_aligned_output_atac<input_id>_atac.bam or if preindex = true, <input_id>_atac.bam.BB.bamBAM file containing aligned reads from ATAC workflow; contains sample and cell barcodes stored in the BB tag if preindex is “true”.
fragment_file_atac<input_id>_atac.fragments.sorted.tsv.gzBgzipped TSV file containing fragment start and stop coordinates per barcode. The columns are "Chromosome", "Start", "Stop", "Barcode", and "Number of reads". When preindex = true, the file has additional columns include "Sample Barcode", "Cell Barcode", and "Duplicates" (which indicates if a cell barcode matches more than one sample barcode).
snap_metrics_atac<input_id>_atac.metrics.h5adh5ad (Anndata) file containing per-barcode metrics from SnapATAC2. See the ATAC Count Matrix Overview for more details. If the preindex option is used, the h5ad.obs will contain 3 extra columns: preindex (the sample barcode), CB (cell barcodes), and duplicates (indicates with a 1 if the cell barcode matches more than preindex, otherwise it is 0).
genomic_reference_version_gex<reference_version>.txtFile containing the Genome build, source and GTF annotation version.
bam_gex<input_id>_gex.bamBAM file containing aligned reads from Optimus workflow.
matrix_gex<input_id>_gex_sparse_counts.npzNPZ file containing raw gene by cell counts.
matrix_row_index_gex<input_id>_gex_sparse_counts_row_index.npyNPY file containing the row indices.
matrix_col_index_gex<input_id>_gex_sparse_counts_col_index.npyNPY file containing the column indices.
cell_metrics_gex<input_id>_gex.cell_metrics.csv.gzCSV file containing the per-cell (barcode) metrics.
gene_metrics_gex<input_id>_gex.gene_metrics.csv.gzCSV file containing the per-gene metrics.
cell_calls_gex<input_id>_gex.emptyDropsTSV file containing the EmptyDrops results when the Optimus workflow is run in sc_rna mode.
h5ad_output_file_gex<input_id>_gex.h5adh5ad (Anndata) file containing the raw cell-by-gene count matrix, gene metrics, cell metrics, and global attributes. See the Optimus Count Matrix Overview for more details.
library_metrics<input_id>_gex_<gex_nhash_id>_library_metrics.csvOptional CSV file containing all library-level metrics calculated with STARsolo for gene expression data.
atac_library_final<input_id>_atac_<atac_nhash_id>_library_metricsCSV file containing all the library-level metrics calucalted by SnapATAC2.
cloud_providerN/AString describing the cloud provider that should be used to run the workflow; value should be "gcp" or "azure".
multimappers_EM_matrixUniqueAndMult-EM.mtxOptional output produced when soloMultiMappers is "EM" (default); see STARsolo documentation for more information.
multimappers_Uniform_matrixUniqueAndMult-Uniform.mtxOptional output produced when soloMultiMappers is "Uniform"; see STARsolo documentation for more information.
multimappers_Rescue_matrixUniqueAndMult-Rescue.mtxOptional output produced when soloMultiMappers is "Rescue"; see STARsolo documentation for more information.
multimappers_PropUnique_matrixUniqueAndMult-PropUnique.mtxOptional output produced when soloMultiMappers is "PropUnique"; see STARsolo documentation for more information.

Versioning and testing

All Paired-Tag pipeline releases are documented in the Paired-Tag changelog and tested using plumbing and scientific test data. To learn more about WARP pipeline testing, see Testing Pipelines. Note that paired-tag tests are still in development.

Citing the Paired-Tag Pipeline

If you use the Paired-Tag Pipeline in your research, please identify the pipeline in your methods section using the Paired-Tag SciCrunch resource identifier.

  • Ex: Paired-Tag Pipeline (RRID:SCR_025041)

Please also consider citing our preprint:

Degatano, K., Awdeh, A., Cox III, R.S., Dingman, W., Grant, G., Khajouei, F., Kiernan, E., Konwar, K., Mathews, K.L., Palis, K., et al. Warp Analysis Research Pipelines: Cloud-optimized workflows for biological data processing and reproducible analysis. Bioinformatics 2025; btaf494. https://doi.org/10.1093/bioinformatics/btaf494

Consortia support

This pipeline is supported by the BRAIN Initiative (BICCN and BICAN).

If your organization also uses this pipeline, we would like to list you! Please reach out to us by filing an issue in WARP.

Acknowledgements

We are immensely grateful to the members of the BRAIN Initiative (BICAN Sequencing Working Group) and SCORCH for their invaluable and exceptional contributions to this pipeline. Our heartfelt appreciation goes to Dr. Bing Ren's lab, Yang Xie, and Lei Chang for their unwavering dedication and remarkable efforts.

Feedback

Please help us make our tools better by filing an issue in WARP; we welcome pipeline-related suggestions or questions.