Skip to main content

Multiome Overview

Pipeline VersionDate UpdatedDocumentation AuthorQuestions or Feedback
Multiome v5.11.0February, 2025WARP PipelinesPlease file an issue in WARP.

Multiome_diagram

Introduction to the Multiome workflow

Multiome is an open-source, cloud-optimized pipeline developed in collaboration with members of the BRAIN Initiative (BICCN and BICAN Sequencing Working Group) and SCORCH (see Acknowledgements below). It supports the processing of 10x 3' single-cell and single-nucleus gene expression (GEX) and chromatin accessibility (ATAC) data generated with the 10x Genomics Multiome assay.

The workflow is a wrapper WDL script that calls two subworkflows: the Optimus workflow for single-cell GEX data and the ATAC workflow for single-cell ATAC data.

The GEX component corrects cell barcodes (CBs) and Unique Molecular Identifiers (UMIs), aligns reads to the genome, calculates per-barcode and per-gene quality metrics, and produces a raw cell-by-gene count matrix. It also produces library-level metrics calculated from STARsolo aligner metrics.

The ATAC component corrects CBs, aligns reads to the genome, calculates per-barcode quality metrics, library-level metrics and produces a fragment file.

The wrapper WDL is available in the WARP repository (see the code here).

Quickstart table

The following table provides a quick glance at the Multiome pipeline features:

Pipeline featuresDescriptionSource
Assay type10x single cell or single nucleus gene expression (GEX) and ATAC10x Genomics
Overall workflowBarcode correction, read alignment, gene and fragment quantification
Workflow languageWDL 1.0openWDL
Genomic Reference SequenceGRCh38 human genome primary sequenceGENCODE human reference files
Gene annotation reference (GTF)Reference containing gene annotationsGENCODE human GTF
AlignersSTARsolo (GEX), BWA-mem2 (ATAC)Kaminow et al. 2021, Vasimuddin et al. 2019
Transcript and fragment quantificationSTARsolo (GEX), SnapATAC2 (ATAC)Kaminow et al. 2021, SnapATAC2
Data input file formatFile format in which sequencing data is providedFASTQ
Data output file formatFile formats in which Multiome output is providedBAM and h5ad
Library-level metricsLibrary-level metrics produced by the Optimus and ATAC workflowsOptimus ibrary-level metrics and ATAC library-level metrics

Set-up

Multiome installation

To download the latest Multiome release, see the release tags prefixed with "Multiome" on the WARP releases page. All Multiome pipeline releases are documented in the Multiome changelog.

To discover and search releases, use the WARP command-line tool Wreleaser.

If you’re running a Multiome workflow version prior to the latest release, the accompanying documentation for that release may be downloaded with the source code on the WARP releases page (see the source code folder).

Multiome can be deployed using Cromwell, a GA4GH-compliant, flexible workflow management system that supports multiple computing platforms. The workflow can also be run in Terra, a cloud-based analysis platform. The Multiome public workspace on Terra contains the Multiome workflow, workflow configuration, required reference data and other inputs, and example testing data.

Inputs

Input nameDescriptionType
input_idUnique identifier describing the biological sample or replicate that corresponds with the FASTQ files; can be a human-readable name or UUID.String
cloud_providerString describing the cloud provider that should be used to run the workflow; value should be "gcp" or "azure".String
gex_nhash_idOptional identifier for the library aliquot; when specified, the gene expression workflow will echo the ID in the gene expression output h5ads (in the adata.uns section) and in the library-level metrics CSV.
atac_nhash_idOptional identifier for the library aliquot; when specified, the workflow will echo the ID in the ATAC output h5ads (in the adata.uns section) and in the library-level metrics CSV.
expected_cellsNumber of cells loaded for library preparation; default is set to 3000.Integer
annotations_gtfGTF file containing gene annotations used for GEX cell metric calculation and ATAC fragment metrics; must match the GTF used to build the STAR aligner.File
gex_r1_fastqArray of read 1 FASTQ files representing a single GEX 10x library.Array[File]
gex_r2_fastqArray of read 2 FASTQ files representing a single GEX 10x library.Array[File]
gex_i1_fastqOptional array of index FASTQ files representing a single GEX 10x library; multiplexed samples are not currently supported, but the file may be passed to the pipeline.Array[File]
tar_star_referenceTAR file containing a species-specific reference genome and GTF for Optimus (GEX) pipeline.File
mt_genesOptional file for the Optimus (GEX) pipeline containing mitochondrial gene names used for metric calculation; default assumes 'mt' prefix in GTF (case insensitive).File
counting_modeOptional string that determines whether the Optimus (GEX) pipeline should be run in single-cell mode (sc_rna) or single-nucleus mode (sn_rna); default is "sn_rna".String
tenx_chemistry_versionOptional integer for the Optimus (GEX) pipeline specifying the 10x version chemistry the data was generated with; validated by examination of the first read 1 FASTQ file read structure; default is "3".Integer
emptydrops_lowerOptional threshold for UMIs for the Optimus (GEX) pipeline that empty drops tool should consider for determining cell; data below threshold is not removed; default is "100".Integer
force_no_checkOptional boolean for the Optimus (GEX) pipeline indicating if the pipeline should perform checks; default is "false".Boolean
ignore_r1_read_lengthOptional boolean for the Optimus (GEX) pipeline indicating if the pipeline should ignore barcode chemistry check; if "true", the workflow will not ensure the 10x_chemistry_version input matches the chemistry in the read 1 FASTQ; default is "false".Boolean
star_strand_modeOptional string for the Optimus (GEX) pipeline for performing STARsolo alignment on forward stranded, reverse stranded, or unstranded data; default is "Forward".String
count_exonsDeprecated and removed in Multiome v7.0.0. This parameter is no longer accepted by the workflow; sn_rna mode now always produces a single whole-transcript count matrix.N/A
soloMultiMappersOptional string describing whether or not the Optimus (GEX) pipeline should run STARsolo with the --soloMultiMappers flag.String
atac_r1_fastqArray of read 1 paired-end FASTQ files representing a single 10x multiome ATAC library.Array[File]
atac_r2_fastqArray of barcodes FASTQ files representing a single 10x multiome ATAC library.Array[File]
atac_r3_fastqArray of read 2 paired-end FASTQ files representing a single 10x multiome ATAC library.Array[File]
tar_bwa_referenceTAR file containing the reference index files for BWA-mem alignment for the ATAC pipeline.File
chrom_sizesFile containing the genome chromosome sizes; used to calculate ATAC fragment file metrics.File
adapter_seq_read1Optional string describing the adapter sequence for ATAC read 1 paired-end reads to be used during adapter trimming with Cutadapt; default is "GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG".String
adapter_seq_read3Optional string describing the adapter sequence for ATAC read 2 paired-end reads to be used during adapter trimming with Cutadapt; default is "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG".String
run_cellbenderOptional boolean used to determine if the Optimus (GEX) pipeline should run CellBender on the output gene expression h5ad file, h5ad_output_file_gex; default is "false".Boolean
run_peak_callingOptional boolean used to determine if the ATAC pipeline should run Peak Calling; default is false. When set to true, the pipeline takes the ATAC h5ad produced by the JoinBarcodes task and performs peak calling to produce a cell by bin matrix and a cell by peak matrix.Boolean
vm_sizeString defining the Azure virtual machine family for the workflow (default: "Standard_M128s").String

Sample inputs for analyses in a Terra Workspace

The Multiome pipeline is currently available on the cloud-based platform Terra. After registering, you can access the Multiome public workspace which is preloaded with instructions and sample data. Please view the Support Center for more information on using the Terra platform.

Tasks

The Multiome workflow calls two WARP subworkflows, one external subworkflow (optional), and an additional task, which are described briefly in the table below. For more details on each subworkflow and task, see the documentation and WDL scripts linked in the table.

SubworkflowSoftwareDescription
ATAC (WDL and documentation)fastqprocess, bwa-mem, SnapATAC2Workflow used to analyze 10x single-cell ATAC data.
Optimus (WDL and documentation)fastqprocess, STARsolo, EmptydropsWorkflow used to analyze 10x single-cell GEX data.
JoinMultiomeBarcodes as JoinBarcodes (WDL)Python3Task that adds an extra column to the Optimus metrics h5ad.obs property that lists the respective ATAC barcodes for each gene expression barcode. It also adds an extra column to the ATAC metrics h5ad.obs property to link ATAC barcodes to gene expression barcodes.
CellBender.run_cellbender_remove_background_gpu as CellBender (WDL)CellBenderOptional task that runs the cellbender_remove_background.wdl WDL script directly from the CellBender GitHub repository, depending on whether the input run_cellbender is "true" or "false".

Outputs

Output variable nameFilename, if applicableOutput format and description
multiome_pipeline_version_outN.A.String describing the version of the Multiome pipeline used.
gex_whitelist_usedgex_whitelist_input.txtFile describing the whitelist used for the Optimus pipeline
atac_whitelist_usedatac_whitelist_input.txtFile describing the whitelist used for the ATAC pipeline
bam_aligned_output_atac<input_id>_atac.bamBAM file containing aligned reads from ATAC workflow.
fragment_file_atac<input_id>_atac.fragments.sorted.tsv.gzSorted and bgzipped TSV file containing fragment start and stop coordinates per barcode. The columns are "Chromosome", "Start", "Stop", "ATAC Barcode", "Number of reads", and "GEX Barcode".
fragment_file_index<input_id>_atac.fragments.sorted.tsv.gz.csiTabix CSI index file for the fragment file.
snap_metrics_atac<input_id>_atac.metrics.h5adh5ad (Anndata) file containing per-barcode metrics from SnapATAC2. Also contains the equivalent gene expression barcode for each ATAC barcode in the gex_barcodes column of the h5ad.obs property. See the ATAC Count Matrix Overview for more details.
atac_library_metrics<input_id>_atac_<nhash_id>_library_metrics.csvCSV with library-level metrics produced by SnapATAC2. See the ATAC Library Level Metrics Overview for more details.
genomic_reference_version_gex<reference_version>.txtFile containing the Genome build, source and GTF annotation version.
bam_gex<input_id>_gex.bamBAM file containing aligned reads from Optimus workflow.
matrix_gex<input_id>_gex_sparse_counts.npzNPZ file containing raw gene by cell counts.
matrix_row_index_gex<input_id>_gex_sparse_counts_row_index.npyNPY file containing the row indices.
matrix_col_index_gex<input_id>_gex_sparse_counts_col_index.npyNPY file containing the column indices.
cell_metrics_gex<input_id>_gex.cell_metrics.csv.gzCSV file containing the per-cell (barcode) metrics.
gene_metrics_gex<input_id>_gex.gene_metrics.csv.gzCSV file containing the per-gene metrics.
cell_calls_gex<input_id>_gex.emptyDropsTSV file containing the EmptyDrops results when the Optimus workflow is run in sc_rna mode.
h5ad_output_file_gex<input_id>_gex.h5adh5ad (Anndata) file containing the raw cell-by-gene count matrix, gene metrics, cell metrics, and global attributes. Also contains equivalent ATAC barcode for each gene expression barcode in the atac_barcodes column of the h5ad.obs property. See the Optimus Count Matrix Overview for more details.
multimappers_EM_matrixUniqueAndMult-EM.mtxOptional output produced when soloMultiMappers is "EM"; see STARsolo documentation for more information.
multimappers_Uniform_matrixUniqueAndMult-Uniform.mtxOptional output produced when soloMultiMappers is "Uniform"; see STARsolo documentation for more information.
multimappers_Rescue_matrixUniqueAndMult-Rescue.mtxOptional output produced when soloMultiMappers is "Rescue"; see STARsolo documentation for more information.
multimappers_PropUnique_matrixUniqueAndMult-PropUnique.mtxOptional output produced when soloMultiMappers is "PropUnique"; see STARsolo documentation for more information.
gex_aligner_metrics<input_id>_gex.star_metrics.tarText file containing per barcode metrics (CellReads.stats) produced by the GEX pipeline STARsolo aligner.
library_metrics<input_id>_gex_<gex_nhash_id>_library_metrics.csvOptional CSV file containing all library-level metrics calculated with STARsolo for gene expression data.
mtx_files<input_id>_gex.mtx_files.tarTAR file with STARsolo matrix market files (barcodes.tsv, features.tsv, and matrix.mtx)
cell_barcodes_csv<cell_csv>Optional output produced when run_cellbender is "true"; see CellBender documentation and GitHub repository for more information.
checkpoint_file<ckpt_file>Optional output produced when run_cellbender is "true"; see CellBender documentation and GitHub repository for more information.
h5_array<h5_array>Optional output produced when run_cellbender is "true"; see CellBender documentation and GitHub repository for more information.
html_report_array<report_array>Optional output produced when run_cellbender is "true"; see CellBender documentation and GitHub repository for more information.
log<log>Optional output produced when run_cellbender is "true"; see CellBender documentation and GitHub repository for more information.
metrics_csv_array<metrics_array>Optional output produced when run_cellbender is "true"; see CellBender documentation and GitHub repository for more information.
output_directory<output_dir>Optional output produced when run_cellbender is "true"; see CellBender documentation and GitHub repository for more information.
summary_pdf<pdf>Optional output produced when run_cellbender is "true"; see CellBender documentation and GitHub repository for more information.
cellbybin_h5ad_fileh5adCell by bin matrix produced by SnapATAC2 peak calling. This matrix contains (unmerged) peaks in the MACS3 unstructured metadata (adata.uns['MACS3']). The matrix consists of insertion counts per 500 bp genomic bin and cell barcode.
cellbypeak_h5ad_fileh5adCell by peak matrix produced by SnapATAC2 peak calling. This matrix contains insertion counts per (merged) peak coordinates and per cell barcode.

Provenance metadata (whitelist): The v6.1.5 Multiome pipeline now records the barcode whitelist used during processing in the .uns metadata of both GEX and ATAC h5ad outputs.. This is a provenance-only update and does not alter any counts, metrics, or downstream results.

You can inspect the whitelist file path in Python as follows:

import anndata

adata = anndata.read_h5ad("<file_name>.h5ad")
print(adata.uns["whitelists"])

Versioning and testing

All Multiome pipeline releases are documented in the Multiome changelog and tested using plumbing and scientific test data. To learn more about WARP pipeline testing, see Testing Pipelines.

Citing the Multiome Pipeline

If you use the Multiome Pipeline in your research, please identify the pipeline in your methods section using the Multiome SciCrunch resource identifier.

  • Ex: Multiome Pipeline (RRID:SCR_024217)

When citing WARP, please use the following:

Kylee Degatano, Aseel Awdeh, Robert Sidney Cox III, Wes Dingman, George Grant, Farzaneh Khajouei, Elizabeth Kiernan, Kishori Konwar, Kaylee L Mathews, Kevin Palis, Nikelle Petrillo, Geraldine Van der Auwera, Chengchen (Rex) Wang, Jessica Way. "Warp Analysis Research Pipelines: Cloud-optimized workflows for biological data processing and reproducible analysis." Bioinformatics, 2025; https://doi.org/10.1093/bioinformatics/btaf494 .

Consortia support

This pipeline is supported by the BRAIN Initiative (BICCN and BICAN).

If your organization also uses this pipeline, we would like to list you! Please reach out to us by filing an issue in WARP.

Acknowledgements

We are immensely grateful to the members of the BRAIN Initiative (BICAN Sequencing Working Group) and SCORCH for their invaluable and exceptional contributions to this pipeline. Our heartfelt appreciation goes to Alex Dobin, Aparna Bhaduri, Alec Wysoker, Anish Chakka, Brian Herb, Daofeng Li, Fenna Krienen, Guo-Long Zuo, Jeff Goldy, Kai Zhang, Khalid Shakir, Bo Li, Mariano Gabitto, Michael DeBerardine, Mengyi Song, Melissa Goldman, Nelson Johansen, James Nemesh, and Theresa Hodges for their unwavering dedication and remarkable efforts.

Feedback

Please help us make our tools better by filing an issue in WARP; we welcome pipeline-related suggestions or questions.