Redirection

Last updated on 2024-11-19 | Edit this page

Estimated time: 45 minutes

Overview

Questions

  • How can I search within files?
  • How can I combine existing commands to do new things?

Objectives

  • Employ the grep command to search for information within files.
  • Print the results of a command to a file.
  • Construct command pipelines with two or more stages.
  • Use for loops to run the same command for several input files.

Searching files

We discussed in a previous episode how to search within a file using less. We can also search within files without even opening them, using grep. grep is a command-line utility for searching plain-text files for lines matching a specific set of characters (sometimes called a string) or a particular pattern (which can be specified using something called regular expressions). We’re not going to work with regular expressions in this lesson, and are instead going to specify the strings we are searching for.

Files are staged for this workshop in /broad/hptmp but data is only allowed to stay on that temporary storage for two weeks. Let’s check that the data we want to use is in the right place.

BASH 

$ ls /broad/hptmp/computing_basics/untrimmed_fastq/SRR09*

If you see the following output, the data is where we expected it to be.

OUTPUT 

/broad/hptmp/computing_basics/untrimmed_fastq/SRR097977.fastq
/broad/hptmp/computing_basics/untrimmed_fastq/SRR098026.fastq

If instead you see an error that untrimmed_fastq is missing, you’ll need to download the data to your home directory before you can proceed with this episode.

OUTPUT 

ls: cannot access /broad/hptmp/computing_basics/untrimmed_fastq/SRR09*: No such file or directory

Download untrimmed_fastq.zip to your home directory and unpack it.

BASH 

$ cd
wget https://github.com/jlchang/cb-unix-shell-lesson-template/raw/main/learners/files/untrimmed_fastq.zip
$ unzip untrimmed_fastq.zip
$ cd untrimmed_fastq

Usually, it’s best to minimize the number of copies of data so there’s a single “source of truth” to reference. If the data is available in /broad/hptmp/computing_basics/untrimmed_fastq, we’re going to have you make a link to the files in your home directory. Soft links (using ln -s) can be thought of as an alias or shortcut to data at a different physical location.

You should skip the following instructions if you’ve downloaded untrimmed_fastq.zip to your home directory and unpacked it (ie. if you followed the instruction in “What if untrimmed_fastq is missing in /broad/hptmp/computing_basics?”)

BASH 

$ cd 
$ mkdir untrimmed_fastq
$ cd untrimmed_fastq
$ ln -s /broad/hptmp/computing_basics/untrimmed_fastq/SRR098026.fastq SRR098026.fastq
$ ln -s /broad/hptmp/computing_basics/untrimmed_fastq/SRR097977.fastq SRR097977.fastq

Nucleotide abbreviations

The four nucleotides that appear in DNA are abbreviated A, C, T and G. Unknown nucleotides are represented with the letter N. An N appearing in a sequencing file represents a position where the sequencing machine was not able to confidently determine the nucleotide in that position. You can think of an N as being aNy nucleotide at that position in the DNA sequence.

Suppose we want to see how many reads in our file have really bad segments containing 10 consecutive unknown nucleotides (Ns).

Determining quality

In this lesson, we’re going to be manually searching for strings of Ns within our sequence results to illustrate some principles of file searching. It can be really useful to do this type of searching to get a feel for the quality of your sequencing results, however, in your research you will most likely use a bioinformatics tool that has a built-in program for filtering out low-quality reads. You can learn how to use one such tool in this Data Carpentries lesson.

Let’s search for the string NNNNNNNNNN in the SRR098026 file (that’s 10 N’s):

BASH 

$ grep NNNNNNNNNN SRR098026.fastq

This command returns a lot of output to the terminal. Every single line in the SRR098026 file that contains at least 10 consecutive Ns is printed to the terminal, regardless of how long or short the file is. We may be interested not only in the actual sequence which contains this string, but in the name (or identifier) of that sequence. We discussed in a previous lesson that the identifier line immediately precedes the nucleotide sequence for each read in a FASTQ file. We may also want to inspect the quality scores associated with each of these reads. To get all of this information, we will return the line immediately before each match and the two lines immediately after each match.

We can use the -B argument for grep to return a specific number of lines before each match. The -A argument returns a specific number of lines after each matching line. Here we want the line before and the two lines after each matching line, so we add -B1 -A2 to our grep command:

BASH 

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq

One of the sets of lines returned by this command is:

OUTPUT 

@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Exercise

  1. Search for the sequence GNATNACCACTTCC in the SRR098026.fastq file. Have your search return all matching lines and the name (or identifier) for each sequence that contains a match.

  2. Search for the sequence AAGTT in both FASTQ files. Have your search return all matching lines and the name (or identifier) for each sequence that contains a match.

  1. grep -B1 GNATNACCACTTCC SRR098026.fastq
@SRR098026.245 HWUSI-EAS1599_1:2:1:2:801 length=35
GNATNACCACTTCCAGTGCTGANNNNNNNGGGATG
  1. grep -B1 AAGTT *.fastq
SRR097977.fastq-@SRR097977.11 209DTAAXX_Lenski2_1_7:8:3:247:351 length=36
SRR097977.fastq:GATTGCTTTAATGAAAAAGTCATATAAGTTGCCATG
--
SRR097977.fastq-@SRR097977.67 209DTAAXX_Lenski2_1_7:8:3:544:566 length=36
SRR097977.fastq:TTGTCCACGCTTTTCTATGTAAAGTTTATTTGCTTT
--
SRR097977.fastq-@SRR097977.68 209DTAAXX_Lenski2_1_7:8:3:724:110 length=36
SRR097977.fastq:TGAAGCCTGCTTTTTTATACTAAGTTTGCATTATAA
--
SRR097977.fastq-@SRR097977.80 209DTAAXX_Lenski2_1_7:8:3:258:281 length=36
SRR097977.fastq:GTGGCGCTGCTGCATAAGTTGGGTTATCAGGTCGTT
--
SRR097977.fastq-@SRR097977.92 209DTAAXX_Lenski2_1_7:8:3:353:318 length=36
SRR097977.fastq:GGCAAAATGGTCCTCCAGCCAGGCCAGAAGCAAGTT
--
SRR097977.fastq-@SRR097977.139 209DTAAXX_Lenski2_1_7:8:3:703:655 length=36
SRR097977.fastq:TTTATTTGTAAAGTTTTGTTGAAATAAGGGTTGTAA
--
SRR097977.fastq-@SRR097977.238 209DTAAXX_Lenski2_1_7:8:3:592:919 length=36
SRR097977.fastq:TTCTTACCATCCTGAAGTTTTTTCATCTTCCCTGAT
--
SRR098026.fastq-@SRR098026.158 HWUSI-EAS1599_1:2:1:1:1505 length=35
SRR098026.fastq:GNNNNNNNNCAAAGTTGATCNNNNNNNNNTGTGCG

Redirecting output

grep allowed us to identify sequences in our FASTQ files that match a particular pattern. All of these sequences were printed to our terminal screen, but in order to work with these sequences and perform other operations on them, we will need to capture that output in some way.

We can do this with something called “redirection”. The idea is that we are taking what would ordinarily be printed to the terminal screen and redirecting it to another location. In our case, we want to print this information to a file so that we can look at it later and use other commands to analyze this data.

The command for redirecting output to a file is >.

Let’s try out this command and copy all the records (including all four lines of each record) in our FASTQ files that contain ‘NNNNNNNNNN’ to another file called bad_reads.txt.

BASH 

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt

If you see something similar to

OUTPUT 

grep: SRR098026.fasta: No such file or directory

grep is telling you it couldn’t find the specified file. Take a close look at the error message. Grep was asked to look for a fasta file instead of fastq… No wonder grep was confused!

If you’re seeing

OUTPUT 

-bash: bad_reads.txt: Permission denied

your current working directory is probably /broad/hptmp/computing_basics/untrimmed_fastq and not ~/untrimmed_fastq

you can use the following command to _p_rint your _w_orking _d_irectory

BASH 

pwd

File extensions

You might be confused about why we’re naming our output file with a .txt extension. After all, it will be holding FASTQ formatted data that we’re extracting from our FASTQ files. Won’t it also be a FASTQ file? The answer is, yes - it will be a FASTQ file and it would make sense to name it with a .fastq extension. However, using a .fastq extension will lead us to problems when we move to using wildcards later in this episode. We’ll point out where this becomes important. For now, it’s good that you’re thinking about file extensions!

The prompt should sit there a little bit, and then it should look like nothing happened. But type ls. You should see a new file called bad_reads.txt.

We can check the number of lines in our new file using a command called wc. wc stands for word count. This command counts the number of words, lines, and characters in a file. The FASTQ file may change over time, so given the potential for updates, make sure your file matches your instructor’s output.

For our copy of these fastq files, wc gives the following output:

BASH 

$ wc bad_reads.txt

OUTPUT 

  537  1073 23217 bad_reads.txt

This will tell us the number of lines, words and characters in the file. If we want only the number of lines, we can use the -l flag for lines.

BASH 

$ wc -l bad_reads.txt

OUTPUT 

537 bad_reads.txt

Exercise

How many sequences are there in SRR098026.fastq? Remember that every sequence is formed by four lines.

BASH 

$ wc -l SRR098026.fastq

OUTPUT 

996

Now you can divide this number by four to get the number of sequences in your fastq file.

This can be done using shell integer arithmetic

BASH 

$ echo $((996/4))

Note, this will do integer division - if you need floating point arithmetic you can use bc - an arbitrary precision calculator

BASH 

$ echo "996/7" | bc -l

OUTPUT 

142.28571428571428571428

Exercise

How many sequences in SRR098026.fastq contain at least 3 consecutive Ns?

BASH 

$ grep NNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT 

249

We might want to search multiple FASTQ files for sequences that match our search pattern. However, we need to be careful, because each time we use the > command to redirect output to a file, the new output will replace the output that was already present in the file. This is called “overwriting” and, just like you don’t want to overwrite your video recording of your kid’s first birthday party, you also want to avoid overwriting your data files.

BASH 

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT 

537 bad_reads.txt

BASH 

$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq > bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT 

0 bad_reads.txt

Here, the output of our second call to wc shows that we no longer have any lines in our bad_reads.txt file. This is because the second file we searched (SRR097977.fastq) does not contain any lines that match our search sequence. So our file was overwritten and is now empty.

We can avoid overwriting our files by using the command >>. >> is known as the “append redirect” and will append new output to the end of a file, rather than overwriting it.

BASH 

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT 

537 bad_reads.txt

BASH 

$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq >> bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT 

537 bad_reads.txt

The output of our second call to wc shows that we have not overwritten our original data.

We can also do this with a single line of code by using a wildcard:

BASH 

$ grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT 

537 bad_reads.txt

File extensions - part 2

This is where we would have trouble if we were naming our output file with a .fastq extension. If we already had a file called bad_reads.fastq (from our previous grep practice) and then ran the command above using a .fastq extension instead of a .txt extension, grep would give us a warning.

BASH 

$ touch bad_reads.fastq # to simulate having an existing bad_reads.fastq file
$ grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.fastq

OUTPUT 

grep: input file ‘bad_reads.fastq' is also the output

grep is letting you know that the output file bad_reads.fastq is also included in your grep call because it matches the *.fastq pattern. Be careful with this file extension gotcha as it can lead to some unintended results.

Since we might have multiple different criteria we want to search for, creating a new output file each time has the potential to clutter up our workspace. We also thus far haven’t been interested in the actual contents of those files, only in the number of reads that we’ve found. We created the files to store the reads and then counted the lines in the file to see how many reads matched our criteria. There’s a way to do this, however, that doesn’t require us to create these intermediate files - the pipe command (|).

Pipes

This is probably not a key you use very much, so let’s all take a minute to find that key. In the UK and US keyboard layouts, and several others, the | character can be found using the key combination Shift+\. The backspace key is typically found near the Return or Enter key. This may be different for other language-specific layouts.

What | does is take the output that is scrolling by on the terminal and uses that output as input to another command. When our output was scrolling by, we might have wished we could slow it down and look at it, like we can with less. Well it turns out that we can! We can redirect our output from our grep call through the less command.

BASH 

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | less

We can now see the output from our grep call within the less interface. We can use the up and down arrows to scroll through the output and use q to exit less.

If we don’t want to create a file before counting lines of output from our grep search, we could directly pipe the output of the grep search to the command wc -l. This can be helpful for investigating your output if you are not sure you would like to save it to a file.

BASH 

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | wc -l

Because we asked grep for all four lines of each FASTQ record, we need to divide the output by four to get the number of sequences that match our search pattern. Since 802 / 4 = 200.5 and we are expecting an integer number of records, there is something added or missing in bad_reads.txt. If we explore bad_reads.txt using less, we might be able to notice what is causing the uneven number of lines. Luckily, this issue happens by the end of the file so we can also spot it with tail.

BASH 

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ tail bad_reads.txt

OUTPUT 

@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
+SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
--
@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

The fifth and six lines in the output display “–” which is the default action for grep to separate groups of lines matching the pattern, and indicate groups of lines which did not match the pattern so are not displayed. To fix this issue, we can redirect the output of grep to a second instance of grep as follows.

BASH 

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | grep -v '^--' > bad_reads.fastq
$ tail bad_reads.fastq

OUTPUT 

+SRR098026.132 HWUSI-EAS1599_1:2:1:0:320 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
+SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

The -v option in the second grep search stands for --invert-match meaning grep will now only display the lines which do not match the searched pattern, in this case '^--'. The caret (^) is an anchoring character matching the beginning of the line, and the pattern has to be enclose by single quotes so grep does not interpret the pattern as an extended option (starting with –).

Custom grep control

Use man grep to read more about other options to customize the output of grep including extended options, anchoring characters, and much more.

Redirecting output is often not intuitive, and can take some time to get used to. Once you’re comfortable with redirection, however, you’ll be able to combine any number of commands to do all sorts of exciting things with your data!

None of the command line programs we’ve been learning do anything all that impressive on their own, but when you start chaining them together, you can do some really powerful things very efficiently.

File manipulation and more practices with pipes

To practice a bit more with the tools we’ve added to our tool kit so far and learn a few extra ones you can follow this extra lesson which uses the SRA metadata file.

Writing for loops

Loops are key to productivity improvements through automation as they allow us to execute commands repeatedly. Similar to wildcards and tab completion, using loops also reduces the amount of typing (and typing mistakes). Loops are helpful when performing operations on groups of sequencing files, such as unzipping or trimming multiple files. We will use loops for these purposes in subsequent analyses, but will cover the basics of them for now.

When the shell sees the keyword for, it knows to repeat a command (or group of commands) once for each item in a list. Each time the loop runs (called an iteration), an item in the list is assigned in sequence to the variable, and the commands inside the loop are executed, before moving on to the next item in the list. Inside the loop, we call for the variable’s value by putting $ in front of it. The $ tells the shell interpreter to treat the variable as a variable name and substitute its value in its place, rather than treat it as text or an external command. In shell programming, this is usually called “expanding” the variable.

Sometimes, we want to expand a variable without any whitespace to its right. Suppose we have a variable named foo that contains the text abc, and would like to expand foo to create the text abcEFG.

BASH 

$ foo=abc
$ echo foo is $foo
foo is abc
$ echo foo is $fooEFG      # doesn't work
foo is

The interpreter is trying to expand a variable named fooEFG, which (probably) doesn’t exist. We can avoid this problem by enclosing the variable name in braces ({ and }, also called “curly brackets”). bash treats the # character as a comment character. Any text on a line after a # is ignored by bash when evaluating the text as code.

BASH 

$ foo=abc
$ echo foo is $foo
foo is abc
$ echo foo is ${foo}EFG      # now it works!
foo is abcEFG

Let’s write a for loop to show us the first two lines of the fastq files we linked to earlier. You will notice the shell prompt changes from $ to > and back again as we were typing in our loop. The second prompt, >, is different to remind us that we haven’t finished typing a complete command yet. A semicolon, ;, can be used to separate two commands written on a single line.

BASH 

$ rm bad_reads.fastq         # lets get rid of this file extension "gotcha" file
$ for filename in *.fastq
> do
> head -n 2 ${filename}
> done

The for loop begins with the formula for <variable> in <group to iterate over>. In this case, the word filename is designated as the variable to be used over each iteration. In our case SRR097977.fastq and SRR098026.fastq will be substituted for filename because they fit the pattern of ending with .fastq in the directory we’ve specified.

The next line of the for loop is do. Followed by a line with the the code that we want to execute. We are telling the loop to print the first two lines of each variable we iterate over.

Finally, the word done ends the loop.

You can also write your for loop all on one line, adding a semicolon before the key words do and done, like so:

BASH 

$ for filename in *.fastq; do head -n 2 ${filename}; done

After executing the loop, you should see the first two lines of both fastq files printed to the terminal. Let’s create a loop that will save this information to a file.

BASH 

$ for filename in *.fastq
> do
> head -n 2 ${filename} >> seq_info.txt
> done

alternate one-liner:

BASH 

$ for filename in *.fastq; do head -n 2 ${filename} >> seq_info.txt; done

When writing a loop, you will not be able to return to previous lines once you have pressed Enter. Remember that we can cancel the current command using

  • Ctrl+C

If you notice a mistake that is going to prevent your loop for executing correctly.

Note that we are using >> to append the text to our seq_info.txt file. If we used >, the seq_info.txt file would be rewritten every time the loop iterates, so it would only have text from the last variable used. Instead, >> adds to the end of the file.

Using Basename in for loops

Basename is a function in UNIX that is helpful for removing a uniform part of a name from a list of files. In this case, we will use basename to remove the .fastq extension from the files that we’ve been working with.

BASH 

$ basename SRR097977.fastq .fastq

We see that this returns just the SRR accession, and no longer has the .fastq file extension on it.

OUTPUT 

SRR097977

If we try the same thing but use .fasta as the file extension instead, nothing happens. This is because basename only works when it exactly matches a string in the file.

BASH 

$ basename SRR097977.fastq .fasta

OUTPUT 

SRR097977.fastq

Basename is really powerful when used in a for loop. It allows to access just the file prefix, which you can use to name things. Let’s try this.

Inside our for loop, we create a new name variable. We call the basename function inside the parenthesis, then give our variable name from the for loop, in this case ${filename}, and finally state that .fastq should be removed from the file name. It’s important to note that we’re not changing the actual files, we’re creating a new variable called name. The line > echo $name will print to the terminal the variable name each time the for loop runs. Because we are iterating over two files, we expect to see two lines of output.

BASH 

$ for filename in *.fastq
> do
> name=$(basename ${filename} .fastq)
> echo ${name}
> done

For this alternate one-liner, notice we also separate commands in the do clause with semicolons:

BASH 

$ for filename in *.fastq; do name=$(basename ${filename} .fastq); echo ${name}; done

Exercise

Print the file prefix of all of the .txt files in our current directory.

BASH 

$ for filename in *.txt
> do
> name=$(basename ${filename} .txt)
> echo ${name}
> done

alternate one-liner:

BASH 

$ for filename in *.txt; do name=$(basename ${filename} .txt); echo ${name}; done

One way this is really useful is to move files. Let’s rename all of our .txt files using mv so that they have the years on them, which will document when we created them.

BASH 

$ for filename in *.txt
> do
> name=$(basename ${filename} .txt)
> mv ${filename} ${name}_2024.txt
> done

alternate one-liner:

BASH 

$ for filename in *.txt; do name=$(basename ${filename} .txt); mv ${filename} ${name}_2024.txt; done

Exercise

Remove _2024 from all of the .txt files.

BASH 

$ for filename in *_2024.txt
> do
> name=$(basename ${filename} _2024.txt)
> mv ${filename} ${name}.txt
> done

alternate one-liner:

BASH 

$ for filename in *_2024.txt; do name=$(basename ${filename} _2024.txt); mv ${filename} ${name}.txt; done

Key Points

  • grep is a powerful search tool with many options for customization.
  • >, >>, and | are different ways of redirecting output.
  • command > file redirects a command’s output to a file.
  • command >> file redirects a command’s output to a file without overwriting the existing contents of the file.
  • command_1 | command_2 redirects the output of the first command as input to the second command.
  • for loops are used for iteration.
  • basename gets rid of repetitive parts of names.