Skip to article frontmatterSkip to article content
Site not loading correctly?

This may be due to an incorrect BASE_URL configuration. See the MyST Documentation for reference.

Using Your Own Data: Setup

To run the pipeline on your own data, you need to prepare a few key input files. This guide details the requirements for each.

1. Samplesheet

The samplesheet is a CSV file that maps your image files to their experimental metadata. It tells the pipeline where to find the images and how they relate to each other (batch, plate, well, site).

Format Requirements

Columns

ColumnDescriptionFormat
pathPath to the directory containing the imagesDirectory path (local or S3)
armExperimental armString (painting or barcoding)
batchBatch identifierString
platePlate identifierString
wellWell identifierString (e.g., A01)
channelsChannel namesString (comma-separated if multiple)
siteSite numberInteger
cycleCycle number (for barcoding)Integer (only for barcoding)
n_framesNumber of frames/channelsInteger

Example

Here’s a minimal example showing one Cell Painting image and two barcoding cycles:

patharmbatchplatewellchannelssitecyclen_frames
/data/painting/WellA1_PointA1_0000_ChannelPhalloidin,CHN2,DNA_Seq0000.ome.tiffpaintingBatch1Plate1A1Phalloidin,CHN2,DNA113
/data/barcoding/WellA1_PointA1_0000_ChannelC,A,T,G,DNA_Seq0000.ome.tiffbarcodingBatch1Plate1A1C,A,T,G,DNA115
/data/barcoding/WellA1_PointA1_0000_ChannelC,A,T,G,DNA_Seq0001.ome.tiffbarcodingBatch1Plate1A1C,A,T,G,DNA125

A more complete samplesheet with multiple wells and sites would have many more rows, one per image file.

2. Barcodes File

This CSV file defines the known barcodes in your library. It is used to map the decoded sequences back to gene identifiers.

Format

Example

barcode_idsequence
id1TAAATAGTAGGATTTACACG
id2TAGGTGATATCAATCGATAC
id3ATAGCTGATTCCATTCGCTA

3. CellProfiler Pipelines (.cppipe)

The pipeline uses CellProfiler for image analysis. You must provide .cppipe files for each stage of the analysis. These files define the image processing modules (e.g., IdentifyPrimaryObjects, MeasureObjectIntensity).

You need to provide paths to these files using the corresponding parameters:

Painting Arm

Barcoding Arm

Combined

Full Parameters

Full parameters can be read from nextflow_schema.json.