Skip to the content.

Steps to set up an analysis pipeline to analyze base editor validation experiments using CRISPResso2:
1. Using the BEV tool on GPP LIMS (available to GPP only) (Jump to steps)
2. On your local machine (Jump to steps)

Running BEV tool on GPP LIMS

Step 1: Sample name

Assign a descriptive name for the samples, without spaces and beginning with your initials (similar to PoolQ).

Step 2: Construct file and Barcode file

Step 3: Conditions file

A .csv file with two columns without headers:
1. Barcode sequences
2. Descriptive condition names without spaces or special characters (e.g. A549_RDA569_RepA_D7_Dropout) because these sample names will be used to name the demultiplexed FASTQ files.

The BEV tool demultiplexes files for you.

Step 4: Batch file

Batch file for a CRISPResso2 run is a .txt file with various columns indicating different parameters for each sample in the run. The batch file for running CRISPResso2 on BEV is similar to the one used for running CRISPResso2 on a local machine, with some differences (bolded). Please refer to the “Sequence_Orientation_Documentation.html” to input the appropriate amplicon and guide sequences.

The different columns in a batch file are as described below:

  1. name: Generate a name of the format, BEV_samplenumber for each sample. For example, the name for sample 1 would be BEV_001, where 001 is the sample number .
  2. identifier: Condition name from conditions file
  3. amplicon_seq: Relevant amplicon sequence for each sample. It is recommended to include the forward and the reverse primers in the amplicon sequence. For more information on how to obtain the right amplicon sequence, refer to “Sequence_Orientation_Documentation.html“.
  4. guide_seq: Sequence of sgRNA for each sample.
  5. Other parameters: The following parameters can be included as columns in the batch file if they are different from the default values of CRISPResso2 which can be found in the documentation. running CRISPResso. For more information on what each of these parameters do, please read the documentation here.
    • -w or --quantification_window_size or --window_around_sgrna: (default: 1) For base editors, we recommend using 20 . Please bear in mind that a wider window results in more reads with sequencing errors being classified as edited. For knockout experiments, the recommendation is to use the default value.
    • -wc or --quantification_window_center or --cleavage_offset: (default: -3) For base editors, we recommend using the center of the guide, i.e. -10 . The default value, i.e. the cut position, can be used for SpCas9 knockout experiments. This parameter can be varied accordingly based on the cut position of the nuclease used.
    • --exclude_bp_from_left: Due to the presence of stagger sequences in our vectors, reads need to be trimmed and the provided trimming adapters cannot be used. To trim the reads on the left end this parameter can be toggled appropriately depending on the position of the sgRNA in the amplicon sequence.
    • --exclude_bp_from_right: This argument can be used to trim reads that have low sequencing quality at the ends.

    Sample batch file shown below:

    name fastq_r1 amplicon_seq guide_seq w wc exclude_bp_from_left exclude_bp_from_right plot_window_size
    BEV_417_F3_R2 A549RDA569_RepA_D7_Dropout GCAGAAAGTCAGTCCCATGGAATTTTCGCTTCCCACAGGTCTCTGCTAGGGGGCTGGGGTTGGGGTGGGGGTGGTGGGCCTGCCCTTCCAATGGATCCACTCACAGTTTCCATAGGTCTGAAAATGTTTCCTGACTCAGAGGGGGCTCGACGCTAGGATCTGACTGCGGCTCCTCCATGGCAGTGACCCGGAAGGCAGTCTGGCTGCTGCAAGAGGAAAAGTGGGGATCCA GCTCCTCCATGGCAGTGACC 20 -10 8 8 40

Step 4: Running CRISPResso2

Enter your email address for the notification email, then click the button that says “Run CRISPResso2.” Similar to PoolQ, you will get a notification if your BEV run dies or succeeds.

Few additional tips/tricks:

Step 5: Analyzing CRISPResso2 results

Please use the “01_BEV_allele_frequencies.ipynb”, “02_BEV_nucleotide_percentage_plots.ipynb” and “03_BEV_editing_efficiency.ipynb”. notebooks in the “notebooks” folder here to further analyze your data.

Running CRISPResso2 on local machine

Step 1: Downloading & demultiplexing files

Step 2: Installing Docker to run CRISPResso2

Running CRISPResso2 via Docker is the easiest way to use it. The way to do this is explained here.

Step 3: Setting up a batch file for CRISPResso2

Batch file for a CRISPResso2 run is a .txt file with various columns indicating different parameters for each sample in the run. This batch file should also be placed in the folder created for the CRISPResso2 run. Please refer to the “Sequence_Orientation_Documentation.html” to input the appropriate amplicon and guide sequences.

The different columns in a batch file are as described below:

  1. name: Generate a name of the format, BEV_samplenumber_primerpair for each sample. For example, the name for sample 1 would be BEV_001, where 001 is the sample number .
  2. fastq_r1: Path to relevant demultiplexed FASTQ input files. It is recommended that you have all FASTQ inputs in a single folder.
  3. amplicon_seq: Relevant amplicon sequence for each sample. It is recommended to include the forward and the reverse primers in the amplicon sequence. For more information on how to obtain the right amplicon sequence, refer to “Sequence_Orientation_Documentation.html“.
  4. guide_seq: Sequence of sgRNA for each sample.
  5. Other parameters: The following parameters can be included as columns in the batch file if they are different for each sample. If they are the same for every sample, they can just be included in the syntax while running CRISPResso. For more information on what each of these parameters do, please read the documentation here.
    • -w or --quantification_window_size or --window_around_sgrna: (default: 1) For base editors, we recommend using 20 . Please bear in mind that a wider window results in more reads with sequencing errors being classified as edited. For knockout experiments, the recommendation is to use the default value.
    • -wc or --quantification_window_center or --cleavage_offset: (default: -3) For base editors, we recommend using the center of the guide, i.e. -10 . The default value, i.e. the cut position, can be used for SpCas9 knockout experiments. This parameter can be varied accordingly based on the cut position of the nuclease used.
    • --exclude_bp_from_left: Due to the presence of stagger sequences in our vectors, reads need to be trimmed and the provided trimming adapters cannot be used. To trim the reads on the left end this parameter can be toggled appropriately depending on the position of the sgRNA in the amplicon sequence.
    • --exclude_bp_from_right: This argument can be used to trim reads that have low sequencing quality at the ends.

    Sample batch file shown below:

    name fastq_r1 amplicon_seq guide_seq w wc
    BEV_010 validation-inputs/BEV/Plate1/BEV_010_F1_A1_R1_A1.construct.fastq.gz GCTATTTAGTGTTATCCAAGGAACATCTTCAGTATCTCTAGGATTCTCTGAGCATGGCAGTTTCTGCTTAT GGAACATCTTCAGTATCTCT 20 -10
    BEV_016 validation-inputs/BEV/Plate1/BEV_016_F1_A2_R1_A2.construct.fastq.gz TTATATACCTTTTGGTTATATCATTCTTACATAAAGGACACTGTGAAGGCCCTTTCTTCTGGTTGAGAA GTTATATCATTCTTACATAA 1 -3

    The sample “BEV_010” is a base editor sample and “BEV_016” is an SpCas9 knockout sample as indicated by the “w” and “wc” columns.

Step 4: Running CRISPResso2

To run CRISPResso2,

  1. Make sure Docker is running on your computer. If it is, you should see the Docker logo on your menu bar which when clicked on should say “Docker Desktop is running”.
  2. Make sure you are running CRISPResso2 in the folder with the batch file. This can be done using the cd command. The outputs will be generated in the same folder as well.
  3. If you are running CRISPResso2 exclusively on base editing samples, please use the –base_edit argument as indicated below.
  4. Finally, open your terminal and type the following command:

    docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoBatch --batch_settings [batch file name] --skip_failed --base_edit

    Few additional tips/tricks:

    • For experiments with both knockout and base editor samples, the quantification window size and window center parameters can be toggled appropriately to run all samples together.
    • –skip_failed is a good argument to use while running CRISPResso2 in batch mode. This argument makes sure the job does not quit if one sample fails. The failed sample can be identified in the RUNNING_LOG file.
    • One common error you may encounter is “CRISPResso batch #x was killed by your system. Please decrease the number of processes (-p) and run again.” Using the --suppress-plots or --suppress-report arguments might help fix this error. If not, please try increasing the number of resources such as “CPUs” and “Memory” in your Docker preferences.
    • If you are encountering an error where CRISPResso2 is not able to align any reads to your reference sequence, first check your reference sequence and then consider changing --default_min_aln_score argument to 50. The default value is 60.

Step 5: Analyzing CRISPResso2 results

Please use the “01_BEV_allele_frequencies.ipynb”, “02_BEV_nucleotide_percentage_plots.ipynb” and “03_BEV_editing_efficiency.ipynb”. notebooks in the “notebooks” folder here to further analyze your data.